JL 4th Gen 1

RSP 11193

Registrant: Medicinal Genomics

General Information

Accession Date
June 26, 2019
Reported Plant Sex
not reported
Mother
RSP11197
Father
RSP11196

This visualization shows how genetically distinctive this strain is compared to every other cultivar in the Kannapedia database. Distinctiveness is measured from the phylogenetic tree using the Fair-Proportion Evolutionary Distinctiveness index: it sums the unique branch length this strain "owns", so a cultivar sitting alone on a long branch scores high (rare), while one buried in a dense cluster of near-identical strains scores low (common). The curve is the distribution of that score across all cultivars, and the marker shows where this strain falls — so you can see, as a single percentile, how unique it is rather than just how far it is from its nearest match.

Rarity: Common

More genetically distinct than 486 of 1490 cultivars (33rd percentile).

The thermometer gauge shows where this strain falls in the range of heterozygosity levels for cannabis cultivars in the Kannapedia database — cooler toward the low (less heterozygous) end, warmer toward the high end, with a tick marking the population average. The marker shows this particular strain, and the caption gives its percentile; strains in the extreme tails are flagged "unusually high" or "unusually low." Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 0.92%
Interactive 3D Cannabis Atlas See JL 4th Gen 1 in the tree of life Spin, zoom, and explore exactly where JL 4th Gen 1 sits among its closest genetic relatives. Launch 3D tree

Genetic Information

About this report

This report identifies predicted high-impact variants in selected cannabis genes based on DNA sequence. For most genes, the report shows the count of such variants and how often they appear in our database. For the cannabinoid synthases THCAS, CBDAS, and CBCAS, the report additionally calls Bt/Bd allele type — whether the gene copy is intact or deleted. Apart from these synthase deletion calls, this report does not measure protein function, gene expression, copy number, or zygosity. Variant effects are predictions, and the gene-level interpretive notes describe what is known about the gene — not specific phenotypic predictions for this plant.

High-impact variants found in fewer than 10% of sequenced strains

0.1% 20%
  • aPT1 p.Glu243* 8.1%
  • aPT4 p.Val79fs 18.9%
  • aPT4 p.Ser80fs 19.0%
  • PKSG-4b p.Phe163fs 64.9%
  • PKSG-4b p.Gly119fs 15.5%
  • PKSG-4b p.Phe80fs 1.6%
  • AAE1-2 p.Asp317fs 16.2%
  • AAE1-2 p.Gln318fs 16.0%
  • AAE1-3 p.Met1? 16.5%
  • HDS-1 c.-108+1_-108+2insG 24.0%
  • TFL1 c.302-1G>A 48.4%
  • TFL1 p.Val17fs 2.8%
  • ELF3 c.1230-2_1230-1delAG 51.7%
  • FAD7A-1 c.*340_*343-4delTATATATATATATATATAGATA 1.6%

Cannabinoid Production

Plant Type Type II THCAS Intact CBDAS Intact CBCAS Intact

Terminal Cannabinoid Synthases

The final enzymes that convert CBGA into THCA, CBDA, or CBCA. Bt/Bd allele typing for these genes provides a direct readout of which terminal synthase copies are intact, which usually corresponds to a known chemotype designation.

THCAS encodes tetrahydrocannabinolic acid synthase, the terminal enzyme that produces THCA from CBGA. THCAS and CBDAS compete for the same substrate, so the relative status of each shapes the THC:CBD ratio.

What this means

This report calls Bt/Bd allele type for THCAS — whether the gene copy is intact or deleted. A deleted THCAS allele is associated with hemp-type chemotypes; an intact allele is associated with the capacity for THC production. Predicted high-impact variants are reported separately and indicate sequence-level changes whose functional consequence depends on factors this report does not measure.

Evidence
Well-characterized in cannabis
Bt/Bd allele type
Intact
Predicted high-impact variants
None detected

CBDAS encodes cannabidiolic acid synthase, the terminal enzyme that produces CBDA from CBGA. It is the defining enzyme for CBD-dominant chemotypes.

What this means

This report calls Bt/Bd allele type for CBDAS. An intact CBDAS allele is associated with the capacity for CBD production; a deleted allele is associated with chemotypes lacking CBD. Combined with THCAS allele status, this directly informs the chemotype class.

Evidence
Well-characterized in cannabis
Bt/Bd allele type
Intact
Predicted high-impact variants
None detected

CBCAS produces cannabichromenic acid (CBCA) from CBGA. CBC is a minor cannabinoid in most strains but accumulates as a major component in some chemotypes.

What this means

This report calls Bt/Bd allele type for CBCAS. The relationship between CBCAS allele status and CBC accumulation is less commonly the dominant driver of overall chemotype than THCAS or CBDAS status, but is informative for minor cannabinoid profiles.

Evidence
Well-characterized in cannabis
Bt/Bd allele type
Intact
Predicted high-impact variants
None detected

Core Biosynthesis

Enzymes that build CBGA, the universal cannabinoid precursor. Several of these genes are present as paralogous copies, and the functional impact of a variant in one copy depends in part on the status of the others.

Olivetolic acid cyclase (OAC) works with the polyketide synthases to produce olivetolic acid, a key intermediate that is then prenylated to form CBGA. OAC activity is required for the canonical cannabinoid biosynthesis pathway.

What this means

Cannabis carries two OAC paralogs (OAC-1 and OAC-2). The functional consequence of predicted high-impact variants in one copy depends on the status of the other and on tissue-specific expression patterns, neither of which this report measures.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
3.2%
OAC family
  • OAC-2 1 variant · 1.0%

Paralog of OAC-1, also encoding olivetolic acid cyclase. Both copies are presumed to contribute to olivetolic acid production.

What this means

As with OAC-1, the impact of predicted high-impact variants in this copy depends in part on the status of the other paralog. The aggregate paralog summary at the category level is generally more informative than any single OAC gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
1.0%
OAC family
  • OAC-1 2 variants · 3.2%

Aromatic prenyltransferase 1 (also called CBGAS) catalyzes the prenylation step that produces CBGA — the universal precursor to all major cannabinoids. This is a key step in cannabinoid biosynthesis.

What this means

aPT1 is part of a small gene family with aPT4 nearby in the genome. Whether predicted high-impact variants in aPT1 affect total cannabinoid output depends on the status of aPT4 and on expression patterns this report does not measure.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
1
Population frequency
58.2%
aPT family
  • aPT4 4 variants · 30.0%

Closely related paralog of aPT1, located nearby in the genome. May contribute to CBGA production or have a related prenyltransferase role.

What this means

Variants here may be partly buffered by aPT1 if both retain function. The aggregate paralog summary at the category level is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
2
Population frequency
30.0%
aPT family
  • aPT1 3 variants · 58.2%

PKSG-family polyketide synthase that condenses hexanoyl-CoA and malonyl-CoA to produce the polyketide intermediate that OAC cyclizes. One of multiple closely related PKSG copies in the cannabis genome.

What this means

Cannabis carries at least four PKSG copies (PKSG-2a, 2b, 4a, 4b). The aggregate status across all four is more informative than any single copy's variant count, and is summarized at the category level.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
41.1%
PKSG family
  • PKSG-2b 6 variants · 76.7%
  • PKSG-4a No variants
  • PKSG-4b 6 variants · 64.9%

Paralog of PKSG-2a, with closely related function. The PKSG family in cannabis includes multiple closely linked copies with overlapping roles.

What this means

As with PKSG-2a, the aggregate status across the four PKSG copies is more informative than any single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
76.7%
PKSG family
  • PKSG-2a 6 variants · 41.1%
  • PKSG-4a No variants
  • PKSG-4b 6 variants · 64.9%

Member of the PKSG4 subgroup of polyketide synthases. Functions in producing the polyketide intermediate for cannabinoid biosynthesis.

What this means

Aggregate status across the PKSG copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
PKSG family
  • PKSG-2a 6 variants · 41.1%
  • PKSG-2b 6 variants · 76.7%
  • PKSG-4b 6 variants · 64.9%

Paralog of PKSG-4a. Together with PKSG-2a, 2b, and 4a, forms a small gene family of closely related polyketide synthases.

What this means

Aggregate status across the PKSG copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
3
Population frequency
64.9%
PKSG family
  • PKSG-2a 6 variants · 41.1%
  • PKSG-2b 6 variants · 76.7%
  • PKSG-4a No variants

Polyketide & Acyl Metabolism

Enzymes that supply and activate the polyketide precursors used in cannabinoid biosynthesis. Some members of these gene families are cannabinoid-specific in cannabis; others have broader metabolic roles inferred from related plants.

PKSA-family polyketide synthase. In well-studied plants, members of this family produce polyketide compounds beyond the cannabinoid pathway, including chalcones and stilbenes. The cannabis-specific role of PKSA paralogs is less directly defined than for PKSG.

What this means

Effects of variants here are harder to anchor than for the dedicated cannabinoid PKSGs, in part because the cannabis-specific function is less directly characterized.

Evidence
Inferred from homology
Predicted high-impact variants
None detected
PKSA family
  • PKSA-3b 1 variant · 8.7%

Paralog of PKSA-3a. Type III polyketide synthases in plants typically have broader metabolic roles than the cannabinoid-specific PKSGs.

What this means

As with PKSA-3a, the cannabis-specific role is less directly defined than for PKSG. Paralog redundancy may buffer effects of variants in a single copy, though this report does not measure expression of either copy.

Evidence
Inferred from homology
Predicted high-impact variants
None detected
Population frequency
8.7%
PKSA family
  • PKSA-3a No variants

PKSB-family polyketide synthase. Like PKSA, this family typically functions in broader polyketide metabolism in well-studied plants. The cannabis-specific role is not as directly established as for PKSG.

What this means

Variants here may relate to a wider range of secondary metabolites beyond cannabinoids; the specific cannabis function is not directly characterized.

Evidence
Inferred from homology
Predicted high-impact variants
None detected

AAE1 activates hexanoic acid into hexanoyl-CoA, the starter substrate that polyketide synthases extend to produce olivetolic acid. AAE1 has been characterized in cannabis as part of the cannabinoid biosynthesis pathway.

What this means

Cannabis carries three AAE1 paralogs. The aggregate status across all three is more informative than any single copy's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
AAE1 family
  • AAE1-2 6 variants · 30.0%
  • AAE1-3 18 variants · 25.8%

Paralog of AAE1-1. The three AAE1 copies in cannabis may have overlapping or partially specialized roles in acyl-CoA activation.

What this means

Aggregate status across the AAE1 copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
2
Population frequency
30.0%
AAE1 family
  • AAE1-1 No variants
  • AAE1-3 18 variants · 25.8%

Third paralog of AAE1. The presence of three copies suggests gene family expansion, possibly with sub-functionalization across tissues or substrates.

What this means

Aggregate status across the AAE1 copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
1
Population frequency
25.8%
AAE1 family
  • AAE1-1 No variants
  • AAE1-2 6 variants · 30.0%

Sequence Data Downloads

Sequence data files (FASTQ, BAM, VCF, and assemblies) are available to the registered holder of this report. If you are the holder, log in to download. Otherwise, please contact us.

Chemical Information

Cannabinoid and terpenoid information provided by the registrant.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Blockchain Registration Information

Transaction ID
f590df7d905c1ca6123209fe211daef005424188b572a2af73b026b1f7146808
Stamping Certificate
Download PDF (844.7 KB)
SHASUM Hash
6f1633ee977f9c1f4d0eecd955528332ce4fb7b9a5db8ef9f9c359a398145adb

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings