Carmaleonte
RSP 11207
Registrant: John McKay-Colorado State University
General Information
- Sample Name
-
Carmal_1_2016_CSU
- Accession Date
- June 26, 2019
- Reported Plant Sex
- not reported
- Report Type
- StrainSEEK v2 3.2Mb
This visualization shows how genetically distinctive this strain is compared to every other cultivar in the Kannapedia database. Distinctiveness is measured from the phylogenetic tree using the Fair-Proportion Evolutionary Distinctiveness index: it sums the unique branch length this strain "owns", so a cultivar sitting alone on a long branch scores high (rare), while one buried in a dense cluster of near-identical strains scores low (common). The curve is the distribution of that score across all cultivars, and the marker shows where this strain falls — so you can see, as a single percentile, how unique it is rather than just how far it is from its nearest match.
More genetically distinct than 1225 of 1490 cultivars (82nd percentile).
The thermometer gauge shows where this strain falls in the range of heterozygosity levels for cannabis cultivars in the Kannapedia database — cooler toward the low (less heterozygous) end, warmer toward the high end, with a tick marking the population average. The marker shows this particular strain, and the caption gives its percentile; strains in the extreme tails are flagged "unusually high" or "unusually low." Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.
Genetic Information
This report identifies predicted high-impact variants in selected cannabis genes based on DNA sequence. For most genes, the report shows the count of such variants and how often they appear in our database. For the cannabinoid synthases THCAS, CBDAS, and CBCAS, the report additionally calls Bt/Bd allele type — whether the gene copy is intact or deleted. Apart from these synthase deletion calls, this report does not measure protein function, gene expression, copy number, or zygosity. Variant effects are predictions, and the gene-level interpretive notes describe what is known about the gene — not specific phenotypic predictions for this plant.
High-impact variants found in fewer than 10% of sequenced strains
- aPT4 p.Val79fs 18.9%
- aPT4 p.Ser80fs 19.0%
- PKSG-4a p.Met89fs 0.3%
- PKSG-4b c.558-1G>A 0.7%
- PKSG-4b p.Ile179fs 11.0%
- PKSG-4b p.Phe163fs 64.9%
- PKSG-4b p.Gly119fs 15.5%
- PKSG-4b c.316+2T>A 35.1%
- AAE1-3 p.Asn160_Thr161insHisValLysIleLeuLeuLeuIleSerTyrSerSerLeuIlePheTyrTyrPheIleGlyCysTerLysProArgSer 0.1%
- HDS-1 c.-108+1_-108+2insG 24.0%
- GGR p.Ala120fs 0.7%
- GPPs1 p.Glu282fs 6.4%
- TFL1 c.302-1G>A 48.4%
- ELF3 c.1229+2T>C 0.7%
- FAD7A-1 c.*320_*342+3delTCTCTCTCTCTCTCTCTCTCTATATA 0.1%
- FAD7A-1 c.*342+1A>C 0.2%
No high-impact variants below this threshold.
Cannabinoid Production
This chart represents the Illumina sequence coverage over the Bt/Bd allele. These are the three regions in the cannabis genome that impact THCA, CBDA, CBGA production. Coverage over the Active CBDAS gene is highly correlated with Type II and Type III plants as described by Etienne de Meijer. Coverage over the THCA gene is highly correlated with Type I and Type II plants but is anti-correlated with Type III plants. Type I plants require coverage over the inactive CBDA loci and no coverage over the Active CBDA gene. Lack of coverage over the Active CBDA and Active THCA allele are presumed to be Type IV plants (CBGA dominant). While deletions of entire THCAS and CBDAS genes are the most common Bt:Bd alleles observed, it is possible to have plants with these genes where functional expression of the enzyme is disrupted by deactivating point mutations (Kojoma et al. 2006).
Terminal Cannabinoid Synthases
The final enzymes that convert CBGA into THCA, CBDA, or CBCA. Bt/Bd allele typing for these genes provides a direct readout of which terminal synthase copies are intact, which usually corresponds to a known chemotype designation.
THCAS encodes tetrahydrocannabinolic acid synthase, the terminal enzyme that produces THCA from CBGA. THCAS and CBDAS compete for the same substrate, so the relative status of each shapes the THC:CBD ratio.
This report calls Bt/Bd allele type for THCAS — whether the gene copy is intact or deleted. A deleted THCAS allele is associated with hemp-type chemotypes; an intact allele is associated with the capacity for THC production. Predicted high-impact variants are reported separately and indicate sequence-level changes whose functional consequence depends on factors this report does not measure.
- Evidence
- Well-characterized in cannabis
- Bt/Bd allele type
- Deleted
- Predicted high-impact variants
- None detected
CBDAS encodes cannabidiolic acid synthase, the terminal enzyme that produces CBDA from CBGA. It is the defining enzyme for CBD-dominant chemotypes.
This report calls Bt/Bd allele type for CBDAS. An intact CBDAS allele is associated with the capacity for CBD production; a deleted allele is associated with chemotypes lacking CBD. Combined with THCAS allele status, this directly informs the chemotype class.
- Evidence
- Well-characterized in cannabis
- Bt/Bd allele type
- Intact
- Predicted high-impact variants
- None detected
- Population frequency
- 26.7%
CBCAS produces cannabichromenic acid (CBCA) from CBGA. CBC is a minor cannabinoid in most strains but accumulates as a major component in some chemotypes.
This report calls Bt/Bd allele type for CBCAS. The relationship between CBCAS allele status and CBC accumulation is less commonly the dominant driver of overall chemotype than THCAS or CBDAS status, but is informative for minor cannabinoid profiles.
- Evidence
- Well-characterized in cannabis
- Bt/Bd allele type
- Intact
- Predicted high-impact variants
- None detected
Core Biosynthesis
Enzymes that build CBGA, the universal cannabinoid precursor. Several of these genes are present as paralogous copies, and the functional impact of a variant in one copy depends in part on the status of the others.
Olivetolic acid cyclase (OAC) works with the polyketide synthases to produce olivetolic acid, a key intermediate that is then prenylated to form CBGA. OAC activity is required for the canonical cannabinoid biosynthesis pathway.
Cannabis carries two OAC paralogs (OAC-1 and OAC-2). The functional consequence of predicted high-impact variants in one copy depends on the status of the other and on tissue-specific expression patterns, neither of which this report measures.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- Population frequency
- 13.3%
- OAC-2 3 variants · 6.1%
Paralog of OAC-1, also encoding olivetolic acid cyclase. Both copies are presumed to contribute to olivetolic acid production.
As with OAC-1, the impact of predicted high-impact variants in this copy depends in part on the status of the other paralog. The aggregate paralog summary at the category level is generally more informative than any single OAC gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- Population frequency
- 6.1%
- OAC-1 1 variant · 13.3%
Aromatic prenyltransferase 1 (also called CBGAS) catalyzes the prenylation step that produces CBGA — the universal precursor to all major cannabinoids. This is a key step in cannabinoid biosynthesis.
aPT1 is part of a small gene family with aPT4 nearby in the genome. Whether predicted high-impact variants in aPT1 affect total cannabinoid output depends on the status of aPT4 and on expression patterns this report does not measure.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- Population frequency
- 58.2%
- aPT4 5 variants · 30.0%
Closely related paralog of aPT1, located nearby in the genome. May contribute to CBGA production or have a related prenyltransferase role.
Variants here may be partly buffered by aPT1 if both retain function. The aggregate paralog summary at the category level is more informative than this single gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- 2
- Population frequency
- 30.0%
- aPT1 2 variants · 58.2%
PKSG-family polyketide synthase that condenses hexanoyl-CoA and malonyl-CoA to produce the polyketide intermediate that OAC cyclizes. One of multiple closely related PKSG copies in the cannabis genome.
Cannabis carries at least four PKSG copies (PKSG-2a, 2b, 4a, 4b). The aggregate status across all four is more informative than any single copy's variant count, and is summarized at the category level.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- Population frequency
- 41.1%
- PKSG-2b 3 variants · 76.7%
- PKSG-4a 5 variants · 8.3%
- PKSG-4b 9 variants · 64.9%
Paralog of PKSG-2a, with closely related function. The PKSG family in cannabis includes multiple closely linked copies with overlapping roles.
As with PKSG-2a, the aggregate status across the four PKSG copies is more informative than any single gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- Population frequency
- 76.7%
- PKSG-2a 2 variants · 41.1%
- PKSG-4a 5 variants · 8.3%
- PKSG-4b 9 variants · 64.9%
Member of the PKSG4 subgroup of polyketide synthases. Functions in producing the polyketide intermediate for cannabinoid biosynthesis.
Aggregate status across the PKSG copies is more informative than this single gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- 1
- Population frequency
- 8.3%
- PKSG-2a 2 variants · 41.1%
- PKSG-2b 3 variants · 76.7%
- PKSG-4b 9 variants · 64.9%
Paralog of PKSG-4a. Together with PKSG-2a, 2b, and 4a, forms a small gene family of closely related polyketide synthases.
Aggregate status across the PKSG copies is more informative than this single gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- 5
- Population frequency
- 64.9%
- PKSG-2a 2 variants · 41.1%
- PKSG-2b 3 variants · 76.7%
- PKSG-4a 5 variants · 8.3%
Polyketide & Acyl Metabolism
Enzymes that supply and activate the polyketide precursors used in cannabinoid biosynthesis. Some members of these gene families are cannabinoid-specific in cannabis; others have broader metabolic roles inferred from related plants.
PKSA-family polyketide synthase. In well-studied plants, members of this family produce polyketide compounds beyond the cannabinoid pathway, including chalcones and stilbenes. The cannabis-specific role of PKSA paralogs is less directly defined than for PKSG.
Effects of variants here are harder to anchor than for the dedicated cannabinoid PKSGs, in part because the cannabis-specific function is less directly characterized.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- PKSA-3b 1 variant · 8.7%
Paralog of PKSA-3a. Type III polyketide synthases in plants typically have broader metabolic roles than the cannabinoid-specific PKSGs.
As with PKSA-3a, the cannabis-specific role is less directly defined than for PKSG. Paralog redundancy may buffer effects of variants in a single copy, though this report does not measure expression of either copy.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 8.7%
- PKSA-3a No variants
PKSB-family polyketide synthase. Like PKSA, this family typically functions in broader polyketide metabolism in well-studied plants. The cannabis-specific role is not as directly established as for PKSG.
Variants here may relate to a wider range of secondary metabolites beyond cannabinoids; the specific cannabis function is not directly characterized.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 21.5%
AAE1 activates hexanoic acid into hexanoyl-CoA, the starter substrate that polyketide synthases extend to produce olivetolic acid. AAE1 has been characterized in cannabis as part of the cannabinoid biosynthesis pathway.
Cannabis carries three AAE1 paralogs. The aggregate status across all three is more informative than any single copy's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- AAE1-2 6 variants · 30.0%
- AAE1-3 21 variants · 25.8%
Paralog of AAE1-1. The three AAE1 copies in cannabis may have overlapping or partially specialized roles in acyl-CoA activation.
Aggregate status across the AAE1 copies is more informative than this single gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- None detected
- Population frequency
- 30.0%
- AAE1-1 No variants
- AAE1-3 21 variants · 25.8%
Third paralog of AAE1. The presence of three copies suggests gene family expansion, possibly with sub-functionalization across tissues or substrates.
Aggregate status across the AAE1 copies is more informative than this single gene's variant count.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- 1
- Population frequency
- 25.8%
- AAE1-1 No variants
- AAE1-2 6 variants · 30.0%
Secondary Metabolism Precursors
Variants detected in 5 of 6 genes
MEP Pathway & GPP Synthesis
The plastid-localized pathway that produces isoprenoid precursors. Includes DXR, HDS, GGR, and GPP synthase.
DXR (1-deoxy-D-xylulose 5-phosphate reductoisomerase) catalyzes an early step in the MEP pathway, which produces the isoprenoid precursors used to build GPP. GPP is required for both cannabinoid and terpene biosynthesis.
Cannabis carries two DXR copies. The aggregate status across both is more informative than any single copy's variant count. The cannabis-specific role is inferred from work in other plants.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- DXR-2 3 variants · 45.4%
Paralog of DXR-1. Both copies are presumed to contribute to MEP pathway flux.
Aggregate status across the DXR copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 45.4%
- DXR-1 No variants
HDS (4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase) is a downstream MEP pathway enzyme. Like other MEP pathway components, it contributes to the supply of isoprenoid precursors.
The cannabis-specific role is inferred from homology. Aggregate status across HDS copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- 1
- Population frequency
- 64.8%
- HDS-2 3 variants · 54.4%
Paralog of HDS-1. The annotation suggests this copy may correspond to HMBPP reductase activity (sometimes called ISPH/HDR), the final MEP pathway step. Either way, both copies relate to isoprenoid precursor supply.
Aggregate status across HDS copies is more informative than this single gene's variant count. Cannabis-specific function is inferred.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 54.4%
- HDS-1 5 variants · 64.8%
GGR encodes the small (regulatory) subunit of geranyl pyrophosphate synthase. The functional GPP synthase in well-studied plants is a heterodimer; this subunit modulates the activity of the catalytic large subunit.
Variants here may relate to GPP supply, which feeds both cannabinoid and monoterpene biosynthesis. The cannabis-specific role is inferred from homology.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- 1
- Population frequency
- 38.2%
GPP synthase produces geranyl pyrophosphate (GPP), the C10 isoprenoid precursor used in cannabinoid biosynthesis (by aPT1) and in monoterpene biosynthesis. Sometimes annotated as GGPS for related roles in producing longer-chain isoprenoids.
Variants here may relate to GPP supply, with potential effects on both cannabinoid and terpene production. Cannabis-specific role is inferred.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- 1
- Population frequency
- 6.4%
Flowering & Photoperiod
Variants detected in 8 of 10 genes
Floral Integrators & Repressors
Genes at the heart of the flowering decision — promoting or repressing the transition based on environmental and internal signals.
FLOWERING LOCUS T (FT) encodes the mobile florigen signal produced in leaves under inductive photoperiod and transported to the shoot apex to initiate flowering. In well-studied plants it sits at the heart of the flowering decision.
Variants here may be associated with shifts in flowering time or photoperiod responsiveness. The cannabis-specific role is inferred from homology to other plants.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 7.0%
HEADING DATE REPRESSOR 1 (HDR1) was identified in rice as a delayer of flowering under long days. The cannabis homolog is annotated based on sequence similarity; the cannabis-specific function is not directly established.
The connection between HDR variants and flowering behavior in cannabis is putative. Aggregate status across HDR copies is more informative than this single gene's variant count.
- Evidence
- Putative role
- Predicted high-impact variants
- None detected
- HDR-2 No variants
Paralog of HDR-1. Both copies are presumed to play related roles based on homology; cannabis-specific function is not directly established.
Aggregate status across HDR copies is more informative than this single gene's variant count.
- Evidence
- Putative role
- Predicted high-impact variants
- None detected
- HDR-1 No variants
PHL acts in the phytochrome signaling pathway and influences flowering time in response to light quality in well-studied plants. The cannabis homolog presumably contributes to photoperiod sensitivity downstream of light perception.
Variants here may relate to photoperiod sensitivity. Aggregate status across PHL copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 57.0%
- PHL-2 16 variants · 61.1%
Paralog of PHL-1. Both copies are presumed to relate to phytochrome-dependent flowering regulation.
Aggregate status across PHL copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 61.1%
- PHL-1 4 variants · 57.0%
Epigenetic Regulation of Flowering
Genes that control flowering through chromatin modification and gene silencing. Often act upstream of the floral integrators.
FLOWERING LOCUS D (FLD) encodes a histone demethylase that affects flowering in well-studied plants by removing repressive marks at flowering-related loci. Acts in the autonomous flowering pathway.
Variants here may relate to flowering time independently of photoperiod cues. Cannabis-specific role is inferred from homology.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 49.4%
EMBRYONIC FLOWER 1 (EMF1) acts with Polycomb Repressive Complex 2 in Arabidopsis to maintain repression of flowering genes during vegetative growth. Loss-of-function mutants in Arabidopsis show extremely early flowering and altered meristem identity.
Aggregate status across EMF1 copies is more informative than this single gene's variant count. Cannabis-specific role is inferred from Arabidopsis.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 5.6%
- EMF1-2 3 variants · 36.2%
Paralog of EMF1-1. Both copies are presumed to contribute to Polycomb-mediated repression of flowering.
Aggregate status across EMF1 copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 36.2%
- EMF1-1 1 variant · 5.6%
EMF2 is a core component of Polycomb Repressive Complex 2 (PRC2) in Arabidopsis, which deposits the repressive H3K27me3 mark at flowering and developmental genes. Acts together with EMF1 to maintain vegetative identity.
Variants here may relate to broad changes in flowering and development given the wide range of PRC2 targets. Cannabis-specific role is inferred from Arabidopsis.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 58.4%
Determinacy & Growth Habit
Genes affecting whether the plant grows indeterminately (continued apical growth) or determinately (terminal flower). Influences overall architecture.
TERMINAL FLOWER 1 (TFL1) is closely related to FT but acts as its functional antagonist in well-studied plants, repressing the flowering transition at the shoot apex and maintaining indeterminate growth. The FT/TFL1 balance shapes plant architecture.
Variants here may be associated with shifts toward more determinate growth and altered branching pattern. Cannabis-specific role is inferred from homology.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- 1
- Population frequency
- 48.4%
Autoflower / Day-Neutrality
Variants detected in 5 of 5 genes
Circadian Clock / Evening Complex
Components of the evening complex and related circadian regulators. In cannabis, ELF3 variants have been linked to day-neutral flowering.
EARLY FLOWERING 3 (ELF3) is a key component of the evening complex that gates circadian and photoperiodic responses in Arabidopsis. In cannabis, published genetic mapping has linked ELF3 variants to the autoflowering (day-neutral) phenotype.
Of the genes in this category, ELF3 has the most direct evidence in cannabis. Predicted high-impact variants here are the most plausible single-gene explanation for an autoflower phenotype, though confirming this requires functional or breeding validation that this report does not provide.
- Evidence
- Well-characterized in cannabis
- Predicted high-impact variants
- 1
- Population frequency
- 64.9%
EARLY FLOWERING 4 (ELF4) partners with ELF3 in the evening complex in Arabidopsis. While ELF3 is the established autoflower gene in cannabis, ELF4 has a related role and may contribute to flowering behavior.
Variants here are not the established cannabis autoflower mechanism. Direct evidence in cannabis is more limited than for ELF3.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 4.7%
ELF5 in Arabidopsis is a flowering time regulator related to but distinct from the evening complex. Its role in cannabis flowering is plausible based on homology but not directly demonstrated.
Variants here have a less certain connection to the autoflower phenotype than ELF3. Useful as supporting context rather than a primary signal.
- Evidence
- Putative role
- Predicted high-impact variants
- None detected
- Population frequency
- 3.4%
Chromatin Remodeling
Chromatin-level regulators that influence flowering independence from photoperiod in well-studied plants. Direct evidence in cannabis is limited.
PHOTOPERIOD-INDEPENDENT EARLY FLOWERING 1 (PIE1) is a chromatin remodeling ATPase that affects flowering in Arabidopsis through deposition of histone variants at flowering-related loci. The cannabis-specific role is not directly established.
Variants here may relate to photoperiod-independent flowering through a chromatin-level mechanism distinct from ELF3, but the cannabis-specific evidence is more limited. Aggregate status across PIE1 copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 54.2%
- PIE1-2 13 variants · 46.0%
Paralog of PIE1-1. Both copies are presumed to contribute to chromatin-level regulation of flowering.
Aggregate status across PIE1 copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 46.0%
- PIE1-1 5 variants · 54.2%
Seed Quality
Variants detected in 4 of 5 genes
Fatty Acid Metabolism
Desaturases and related enzymes that determine the fatty acid profile of seed oil.
FAD2 (delta-12 desaturase) converts oleic acid to linoleic acid in seed oil in well-studied plants, a key step shaping the polyunsaturated fatty acid content of hemp seed oil.
Variants here may relate to the oleic-to-linoleic ratio in seed oil, with implications for nutritional and shelf-life properties. Cannabis carries two FAD2 copies; aggregate status is more informative than any single copy's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- FAD2-2 3 variants · 33.7%
Paralog of FAD2. Both copies are presumed to contribute to linoleic acid production in seed oil.
Aggregate status across FAD2 copies is more informative than this single gene's variant count.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 33.7%
- FAD2 No variants
FAD4 contributes to the desaturation of specific membrane and storage lipids in well-studied plants. Less directly tied to seed oil composition than FAD2 and FAD7, but part of the broader lipid metabolism story.
Variants here likely relate more subtly to the overall fatty acid profile than for FAD2 or FAD7.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 7.5%
FAD7 (omega-3 desaturase) converts linoleic acid to alpha-linolenic acid in well-studied plants, the omega-3 fatty acid associated with hemp seed oil's nutritional profile.
Variants here may relate to the omega-6 to omega-3 ratio in seed oil. Cannabis-specific function is inferred from homology.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- 2
- Population frequency
- 0.2%
Storage Proteins
Proteins that accumulate in the seed and contribute to nutritional value.
Edestin is the dominant storage protein in hemp seeds and a major contributor to their nutritional protein content. The annotation as similar to 2S albumin reflects the broader seed storage protein family.
Variants here may relate to total seed protein content or amino acid composition. Most relevant for hemp varieties grown for seed.
- Evidence
- Inferred from homology
- Predicted high-impact variants
- None detected
- Population frequency
- 15.2%
Genetic Relatives
Nearest
- Chamaeleon (SRR14708197) — 0.201
- Fedora 17 (RSP11203) — 0.209
- Carmagnola/USO 31 (RSP11204) — 0.211
- Tygra (RSP10667) — 0.215
- Ivory (RSP10668) — 0.217
- VIR 507 - Krasnodarsky 10 FB (SRR14708229) — 0.224
- USO31 (RSP10233) — 0.225
- R1in136 (SRR14708226) — 0.225
- Ferimon 12 (SRR14708233) — 0.226
- Santhica27 (RSP10056) — 0.226
- Fedora 17 (RSP10661) — 0.228
- Beniko (SRR14708275) — 0.228
- Carmagnola (RSP11202) — 0.231
- Futura 75 (RSP10664) — 0.231
- USO 31 (RSP10983) — 0.233
- R1in136 (SRR14708227) — 0.237
- Santhica27 (RSP11047) — 0.238
- Carmagnola (RSP10979) — 0.239
- CS (RSP11208) — 0.240
- Fedora 17 (SRR14708222) — 0.240
Most Distant
- JL yellow (RSP11075) — 0.486
- Cherry Blossom (RSP11318) — 0.463
- Cherry Blossom (RSP11301) — 0.461
- JL 3rd Gen Mother (RSP11214) — 0.459
- JL_Tent_4 (RSP11491) — 0.458
- JL 3rd Gen Mother (RSP11197) — 0.455
- JL_Tent_1_yellow_stake (RSP11488) — 0.452
- JL 4th Gen 5 (RSP11199) — 0.451
- Cherry Blossom (RSP11328) — 0.449
- Cherry Blossom (RSP11300) — 0.446
- Cherry Blossom (RSP11323) — 0.443
- Cherry Blossom (RSP11312) — 0.438
- JL Cross 15 (RSP11516) — 0.438
- Cherry Blossom (RSP11325) — 0.435
- Blue Dream (RSP11004) — 0.434
- Cherry Blossom (RSP11322) — 0.434
- Chematonic (Cannatonic x Chemdawg) (RSP11394) — 0.433
- Blue Dream (RSP11227) — 0.433
- Wilburs Great Adventure (RSP11727) — 0.433
- JL Cross 7 (RSP11508) — 0.431
Sequence Data Downloads
Sequence data files (FASTQ, BAM, VCF, and assemblies) are available to the registered holder of this report. If you are the holder, log in to download. Otherwise, please contact us.
Chemical Information
Cannabinoid and terpenoid information provided by the registrant.
Cannabinoids
No information provided.
Terpenoids
No information provided.
Blockchain Registration Information
- Transaction ID
-
45ff8e8575eb5ea2
f4ab0fe44cde6335 a43ae74fe6bd86c0 a6f837d696c0e416 - Stamping Certificate
- Download PDF (857.9 KB)
- SHASUM Hash
-
404a96e1ef5f11a615c3b64929b36953 36890a458eebf34e 33e5247f2e22b837