IUP1

SRR 14708258

Registrant: Lanzhou University, Guangpeng Ren

General Information

Accession Date
May 31, 2021
Reported Plant Sex
not reported

This visualization shows how genetically distinctive this strain is compared to every other cultivar in the Kannapedia database. Distinctiveness is measured from the phylogenetic tree using the Fair-Proportion Evolutionary Distinctiveness index: it sums the unique branch length this strain "owns", so a cultivar sitting alone on a long branch scores high (rare), while one buried in a dense cluster of near-identical strains scores low (common). The curve is the distribution of that score across all cultivars, and the marker shows where this strain falls — so you can see, as a single percentile, how unique it is rather than just how far it is from its nearest match.

Rarity: Uncommon

More genetically distinct than 1201 of 1515 cultivars (79th percentile).

The thermometer gauge shows where this strain falls in the range of heterozygosity levels for cannabis cultivars in the Kannapedia database — cooler toward the low (less heterozygous) end, warmer toward the high end, with a tick marking the population average. The marker shows this particular strain, and the caption gives its percentile; strains in the extreme tails are flagged "unusually high" or "unusually low." Heterozygosity is associated with heterosis (aka hybrid vigor) but also leads to the production of more variable offspring. When plants have two genetically different parents, heterozygosity levels will be higher than if it has been inbred or backcrossed repeatedly.

Heterozygosity: 1.2%
Interactive 3D Cannabis Atlas See IUP1 in the tree of life Spin, zoom, and explore exactly where IUP1 sits among its closest genetic relatives. Launch 3D tree

Genetic Information

About this report

This report identifies predicted high-impact variants in selected cannabis genes based on DNA sequence. For most genes, the report shows the count of such variants and how often they appear in our database. For the cannabinoid synthases THCAS, CBDAS, and CBCAS, the report additionally calls Bt/Bd allele type — whether the gene copy is intact or deleted. Apart from these synthase deletion calls, this report does not measure protein function, gene expression, copy number, or zygosity. Variant effects are predictions, and the gene-level interpretive notes describe what is known about the gene — not specific phenotypic predictions for this plant.

High-impact variants found in fewer than 10% of sequenced strains

0.1% 20%
  • aPT4 p.Val79fs 19.6%
  • aPT4 p.Ser80fs 19.7%
  • PKSG-2b p.Met1del 0.5%
  • PKSG-4b p.Ile179fs 11.8%
  • PKSG-4b p.Phe163fs 64.7%
  • PKSG-4b p.Gly119fs 16.4%
  • PKSG-4b c.316+2T>A 35.9%
  • AAE1-2 p.Asp317fs 18.0%
  • AAE1-2 p.Gln318fs 17.8%
  • AAE1-3 p.Glu204fs 0.3%
  • HDS-1 c.-108+1_-108+2insG 25.7%
  • GPPs1 p.Glu282fs 6.2%
  • PHL-2 p.Lys1186fs 6.0%
  • PIE1-2 c.902-2A>T 0.2%
  • FAD7A-1 c.*340_*343-4delTATATATATATATATATAGATA 1.6%

Cannabinoid Production

Plant Type Type I THCAS Intact CBDAS Deleted CBCAS Deleted

Terminal Cannabinoid Synthases

The final enzymes that convert CBGA into THCA, CBDA, or CBCA. Bt/Bd allele typing for these genes provides a direct readout of which terminal synthase copies are intact, which usually corresponds to a known chemotype designation.

THCAS encodes tetrahydrocannabinolic acid synthase, the terminal enzyme that produces THCA from CBGA. THCAS and CBDAS compete for the same substrate, so the relative status of each shapes the THC:CBD ratio.

What this means

This report calls Bt/Bd allele type for THCAS — whether the gene copy is intact or deleted. A deleted THCAS allele is associated with hemp-type chemotypes; an intact allele is associated with the capacity for THC production. Predicted high-impact variants are reported separately and indicate sequence-level changes whose functional consequence depends on factors this report does not measure.

Evidence
Well-characterized in cannabis
Bt/Bd allele type
Intact
Predicted high-impact variants
None detected

CBDAS encodes cannabidiolic acid synthase, the terminal enzyme that produces CBDA from CBGA. It is the defining enzyme for CBD-dominant chemotypes.

What this means

This report calls Bt/Bd allele type for CBDAS. An intact CBDAS allele is associated with the capacity for CBD production; a deleted allele is associated with chemotypes lacking CBD. Combined with THCAS allele status, this directly informs the chemotype class.

Evidence
Well-characterized in cannabis
Bt/Bd allele type
Deleted
Predicted high-impact variants
None detected

CBCAS produces cannabichromenic acid (CBCA) from CBGA. CBC is a minor cannabinoid in most strains but accumulates as a major component in some chemotypes.

What this means

This report calls Bt/Bd allele type for CBCAS. The relationship between CBCAS allele status and CBC accumulation is less commonly the dominant driver of overall chemotype than THCAS or CBDAS status, but is informative for minor cannabinoid profiles.

Evidence
Well-characterized in cannabis
Bt/Bd allele type
Deleted
Predicted high-impact variants
None detected

Core Biosynthesis

Enzymes that build CBGA, the universal cannabinoid precursor. Several of these genes are present as paralogous copies, and the functional impact of a variant in one copy depends in part on the status of the others.

Olivetolic acid cyclase (OAC) works with the polyketide synthases to produce olivetolic acid, a key intermediate that is then prenylated to form CBGA. OAC activity is required for the canonical cannabinoid biosynthesis pathway.

What this means

Cannabis carries two OAC paralogs (OAC-1 and OAC-2). The functional consequence of predicted high-impact variants in one copy depends on the status of the other and on tissue-specific expression patterns, neither of which this report measures.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
OAC family
  • OAC-2 No variants

Paralog of OAC-1, also encoding olivetolic acid cyclase. Both copies are presumed to contribute to olivetolic acid production.

What this means

As with OAC-1, the impact of predicted high-impact variants in this copy depends in part on the status of the other paralog. The aggregate paralog summary at the category level is generally more informative than any single OAC gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
OAC family
  • OAC-1 No variants

Aromatic prenyltransferase 1 (also called CBGAS) catalyzes the prenylation step that produces CBGA — the universal precursor to all major cannabinoids. This is a key step in cannabinoid biosynthesis.

What this means

aPT1 is part of a small gene family with aPT4 nearby in the genome. Whether predicted high-impact variants in aPT1 affect total cannabinoid output depends on the status of aPT4 and on expression patterns this report does not measure.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
0.9%
aPT family
  • aPT4 5 variants · 31.6%

Closely related paralog of aPT1, located nearby in the genome. May contribute to CBGA production or have a related prenyltransferase role.

What this means

Variants here may be partly buffered by aPT1 if both retain function. The aggregate paralog summary at the category level is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
2
Population frequency
31.6%
aPT family
  • aPT1 1 variant · 0.9%

PKSG-family polyketide synthase that condenses hexanoyl-CoA and malonyl-CoA to produce the polyketide intermediate that OAC cyclizes. One of multiple closely related PKSG copies in the cannabis genome.

What this means

Cannabis carries at least four PKSG copies (PKSG-2a, 2b, 4a, 4b). The aggregate status across all four is more informative than any single copy's variant count, and is summarized at the category level.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
9.4%
PKSG family
  • PKSG-2b 2 variants · 77.0%
  • PKSG-4a 2 variants · 9.3%
  • PKSG-4b 8 variants · 64.7%

Paralog of PKSG-2a, with closely related function. The PKSG family in cannabis includes multiple closely linked copies with overlapping roles.

What this means

As with PKSG-2a, the aggregate status across the four PKSG copies is more informative than any single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
1
Population frequency
77.0%
PKSG family
  • PKSG-2a 4 variants · 9.4%
  • PKSG-4a 2 variants · 9.3%
  • PKSG-4b 8 variants · 64.7%

Member of the PKSG4 subgroup of polyketide synthases. Functions in producing the polyketide intermediate for cannabinoid biosynthesis.

What this means

Aggregate status across the PKSG copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
Population frequency
9.3%
PKSG family
  • PKSG-2a 4 variants · 9.4%
  • PKSG-2b 2 variants · 77.0%
  • PKSG-4b 8 variants · 64.7%

Paralog of PKSG-4a. Together with PKSG-2a, 2b, and 4a, forms a small gene family of closely related polyketide synthases.

What this means

Aggregate status across the PKSG copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
4
Population frequency
64.7%
PKSG family
  • PKSG-2a 4 variants · 9.4%
  • PKSG-2b 2 variants · 77.0%
  • PKSG-4a 2 variants · 9.3%

Polyketide & Acyl Metabolism

Enzymes that supply and activate the polyketide precursors used in cannabinoid biosynthesis. Some members of these gene families are cannabinoid-specific in cannabis; others have broader metabolic roles inferred from related plants.

PKSA-family polyketide synthase. In well-studied plants, members of this family produce polyketide compounds beyond the cannabinoid pathway, including chalcones and stilbenes. The cannabis-specific role of PKSA paralogs is less directly defined than for PKSG.

What this means

Effects of variants here are harder to anchor than for the dedicated cannabinoid PKSGs, in part because the cannabis-specific function is less directly characterized.

Evidence
Inferred from homology
Predicted high-impact variants
None detected
PKSA family
  • PKSA-3b No variants

Paralog of PKSA-3a. Type III polyketide synthases in plants typically have broader metabolic roles than the cannabinoid-specific PKSGs.

What this means

As with PKSA-3a, the cannabis-specific role is less directly defined than for PKSG. Paralog redundancy may buffer effects of variants in a single copy, though this report does not measure expression of either copy.

Evidence
Inferred from homology
Predicted high-impact variants
None detected
PKSA family
  • PKSA-3a No variants

PKSB-family polyketide synthase. Like PKSA, this family typically functions in broader polyketide metabolism in well-studied plants. The cannabis-specific role is not as directly established as for PKSG.

What this means

Variants here may relate to a wider range of secondary metabolites beyond cannabinoids; the specific cannabis function is not directly characterized.

Evidence
Inferred from homology
Predicted high-impact variants
None detected
Population frequency
23.7%

AAE1 activates hexanoic acid into hexanoyl-CoA, the starter substrate that polyketide synthases extend to produce olivetolic acid. AAE1 has been characterized in cannabis as part of the cannabinoid biosynthesis pathway.

What this means

Cannabis carries three AAE1 paralogs. The aggregate status across all three is more informative than any single copy's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
None detected
AAE1 family
  • AAE1-2 9 variants · 32.7%
  • AAE1-3 10 variants · 27.4%

Paralog of AAE1-1. The three AAE1 copies in cannabis may have overlapping or partially specialized roles in acyl-CoA activation.

What this means

Aggregate status across the AAE1 copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
2
Population frequency
32.7%
AAE1 family
  • AAE1-1 No variants
  • AAE1-3 10 variants · 27.4%

Third paralog of AAE1. The presence of three copies suggests gene family expansion, possibly with sub-functionalization across tissues or substrates.

What this means

Aggregate status across the AAE1 copies is more informative than this single gene's variant count.

Evidence
Well-characterized in cannabis
Predicted high-impact variants
1
Population frequency
27.4%
AAE1 family
  • AAE1-1 No variants
  • AAE1-2 9 variants · 32.7%

Sequence Data Downloads

The blockchain-registered VCF above can be downloaded by anyone, so its hash can be checked independently against the blockchain record. The remaining sequence data files — FASTQ, BAM and assemblies — are available to authorised accounts. Log in to download, or contact us for access.

Autoflower & Early Flowering Markers

Autoflower1
Fixed photoperiod-sensitive
82.1% of WGS database (n=787)
Early1
Homozygous early
2.9% of WGS database
Markers scored
3 / 3
AUTO-1, -2, -3 primary loci
CNV at locus
2 events detected
CNV-INTERGENIC · CNV-DEL-GENE

Database Comparison

787 WGS samples in the Kannapedia database with Autoflower marker data

Autoflower1 distribution
This sample: Fixed photoperiod-sensitive  · 82.1% of the database (646 of 787 samples)
Early1 distribution
This sample: Homozygous early  · 2.9% of the database (23 of 787 samples)

Marker Genotypes

Marker JL Position Genotype Depth Alt / Ref Confidence In database
Autoflower1
AUTO-1 contig865:262,132 WT / Auto 10× 4 / 6 High
3% share this GT
AUTO-2 contig856:6,252,387 WT / WT 14× 0 / 14 Medium
85% share this GT
AUTO-3 contig856:6,470,166 WT / WT 7× 0 / 7 High
84% share this GT
AUTO-4 contig856:6,707,384 Auto / Auto 22× 0 / 22 Low
21% share this GT
AUTO-5 contig856:5,758,585 WT / WT 10× del:1 1 / 9 High
20% share this GT
Early1
EARLY-1 contig246:3,472,589 Early / Early 20× 23 / 0 High
2% share this GT
EARLY-2 contig246:3,482,588 Early / Early 14× 14 / 0 High
33% share this GT

Copy-Number at Locus

Region Candidate gene Est. CN Log₂R Windows Tier
AUTO-1 region — 3.30 0.723 4 Elevated
AUTO-2 / NFYB8 NFYB8 2.05 0.037 15 Typical
AUTO-3 / RAP2-7 RAP2-7 1.20 -0.731 7 (1 NA) Low
AUTO-4 / PRR73 PRR73 2.20 0.137 9 (1 NA) Typical
AUTO-5 region — 0.87 -1.205 17 (16 NA) Low
EARLY / RDR3 RDR3 1.39 -0.525 14 (4 NA) Typical
Paralog block (contig504) — 1.05 -0.929 511 (368 NA) Low
Paralog block (contig856) — 1.84 -0.122 735 (225 NA) Typical

Interpretation

Autoflower1 · AF-FIXED-WT Fixed for the wild-type allele. All informative Autoflower1 markers are homozygous WT, so this line breeds true as photoperiod-sensitive — it will not autoflower, and progeny will not segregate for the trait at this locus.
Early1 · E1-HOM-EARLY Homozygous for the early-flowering allele at Early1. This line breeds true for early flowering and is expected to be the earliest-maturing genotype in the panel, flowering well ahead of wild-type siblings independent of photoperiod.
Copy-number · CNV-INTERGENIC A copy-number variant overlaps the locus but does not touch a named candidate gene. Likely not directly causative, but record it — it can still interfere with marker genotyping if it overlaps a marker position.
Copy-number · CNV-DEL-GENE Deletion overlapping a candidate gene at the locus. Loss of a flowering-time gene is a strong structural candidate for a phenotypic effect — if anything, more informative than a SNP at the same position. Flag for direct inspection; if phenotype data are available, this sample is a priority for association testing.
Method note. These calls are derived from whole-genome variant and copy-number data, not from a validated PACE assay. The Autoflower1 and Early1 diagnostic SNPs are not covered by the CannSNP90 or SS3 genotyping chips, so any chip-genotyped sample relies on linked proxy variants and carries wider uncertainty. Per-marker confidence reflects read depth and mapping quality at each marker position. Use this report to prioritise and plan — not as a substitute for phenotypic confirmation.

Marker panel and loci: Toth JA, Stack GM, Carlson CH, Smart LB (2022). Identification and mapping of major-effect flowering time loci Autoflower1 and Early1 in Cannabis sativa L. Front. Plant Sci. 13:991680. doi:10.3389/fpls.2022.991680

Sex Determination & Monoecy

♀ XX Female — Typical

Sex Determination Locus — Copy Number Analysis

Copy number across the three candidate sex-determination genes and the upstream transposable element insertion site. The pink curve shows the distribution among WGS females (n=706); the dimmed curve shows the other sex for reference. Percentiles are sex-matched.

This sample carries two copies of the X chromosome (CN 1.77), consistent with an XX female or monoecious genotype. The sex-determination locus shows diploid copy number across all three candidate regulatory genes: CsREM16 (CN 2.44) and CsKAN4 (CN 2.09). According to Toscani et al. (2026), CsREM16 is strongly expressed in female tissue across all developmental stages examined and has no Y chromosome counterpart, consistent with its proposed role as a key regulator of female identity. CsKAN4, a KANADI family transcription factor also absent from the Y chromosome, shows higher expression in dioecious females than in monoecious individuals. The upstream regulatory region where a transposable element insertion has been identified in monoecious cultivars shows typical diploid copy number (CN 1.72) in this sample, suggesting no structural disruption at this locus.

These findings are based on whole genome sequencing copy number variant analysis and reflect structural genomic features only. Copy number variation does not directly measure gene expression. Phenotypic interpretation requires additional experimental validation. The biological framework referenced here (Toscani et al., New Phytologist, 2026, doi: 10.1111/nph.71185) represents current research and the proposed sex-determination model has not yet been functionally validated through mutant studies in cannabis. These findings concern inherited monoecy and do not predict stress-induced hermaphroditism (light-leak, photoperiod, or heat-stress herming), which is environmental rather than genetic.

ACS Monoecy Marker

Two linked in-frame indels in exon 4 of the ACS gene (1-aminocyclopropane-1-carboxylate synthase), an enzyme in the ethylene biosynthesis pathway, proposed by Carey et al. (2026) as a candidate X-linked sex-determination marker. The variant haplotype is associated with the monoecious ("hermie") phenotype as a recessive trait. This ACS marker and the CsREM16/CsKAN4 locus above are two independent candidate explanations for X-linked sex determination — both published in 2026 — not two parts of one mechanism. They agree the switch is X-driven with no active Y, but propose different genes as the trigger.

3-bp Insertion
hom-ref
c.1338_1340dup
in-frame
concordant
3-bp Deletion
hom-ref
c.1320_1322del
in-frame

This plant carries two intact copies of the ACS exon-4 region at both marker positions, with no insertion or deletion detected. ACS (1-aminocyclopropane-1-carboxylate synthase) sits in the ethylene biosynthesis pathway, which recent work links to inflorescence sex in cannabis. A plant with this genotype carries the reference sequence at the candidate sex-determination locus and shows none of the marker variation associated with the monoecious ("hermie") phenotype.

These markers are based on Carey, S.B., Bentz, P.C., Lovell, J.T. et al. "An X-linked sex determination mechanism in cannabis and hop," Nature Communications (2026), doi: 10.1038/s41467-026-73233-7, which proposes ACS as a candidate sex-determination gene in cannabis. They are research-grade indicators associated with the monoecious ("hermie") phenotype and are not a validated diagnostic of plant sex, which is also influenced by environment and other genetic loci. This describes inherited (genetic) monoecy only — it does not predict stress-induced hermaphroditism. Herming triggered by light leaks, interrupted dark periods, or heat stress in a genetically stable female is environmental and is not captured by genotype, so a reference result here does not guarantee a plant will not herm under stress.

Read Pileup — ACS Exon 4

contig887:2,354,269–2,354,325 (57 bp). Orange markers indicate the two indel sites. Click to expand.

ACS Exon 4 — contig887:2,354,269–2,354,325

Chemical Information

Cannabinoid and terpenoid information provided by the registrant.

Cannabinoids

No information provided.

Terpenoids

No information provided.

Kannapedia uses cookies

By clicking Allow All, you agree to the storing of cookies on your device to enhance site navigation, analyze site usage, and assist in our marketing efforts.

Customize Settings